Labprice Logo
Menu


FGF6 cloning plasmid
id: LP-CSB-CL008633HU-10ug

FGF6 cloning plasmid

Cusabio

Formulation: 10 μg plasmid + 200μl Glycerol
Length: 627
Sequence: ATGGCCCTGGGACAGAAACTGTTCATCACTATGTCCCGGGGAGCAGGACGTCTGCAGGGCACGCTGTGGGCTCTCGTCTTCCTAGGCATCCTAGTGGGCATGGTGGTGCCCTCGCCTGCAGGCACCCGTGCCAACAACACGCTGCTGGACTCGAGGGGCTGGGGCACCCTGCTGTCCAGGTCTCGCGCGGGGCTAGCTGGAGAGATTGCCGGGGTGAACTGGGAAAGTGGCTATTTGGTGGGGATCAAGCGGCAGCGGAGGCTCTACTGCAACGTGGGCATCGGCTTTCACCTCCAGGTGCTCCCCGACGGCCGGATCAGCGGAACCCACGAGGAGAACCCCTACAGCCTGCTGGAAATTTCCACCGTGGAGCGAGGCGTGGTGAGTCTCTTTGGAGTGAGAAGTGCCCTCTTCGTCGCCATGAACAGTAAAGGAAGATTGTACGCAACGCCCAGCTTCCAAGAAGAATGCAAGTTCAGAGAAACCCTCCTGCCCAACAATTACAATGCCTACGAGTCAGACTTGTACCAAGGGACCTACATTGCCCTGAGCAAATACGGACGGGTAAAGCGGGGCAGCAAGGTGTCCCCGATCATGACTGTCACTCATTTCCTTCCCAGGATCTAA

Description: A cloning plasmid for the FGF6 gene.

Gene name: FGF6
Gene ID: 2251
Accession number: BC121097
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

For research use only.


Size


InStock